Motto: "Whatever that means..."

Well, the ideea of this message was that, considering the issues
of the herpes virus having latency states in trigerminal and sacral
ganglia, while as a preventable or treatment method
can be the known pure oils such as "pure rose oil" or "pure
melissa officinalis" oil applied directly on the affected areas ( for
either
case of HSV1 or HSV2, which are lips and respetively genital and such
areas),
to further develop my above ideea,
why not apply these oils on top of skin on the top of the spine
respectively bottom of the spine where the viruses originate.

Would this method eventually help our body heal itself?

In other words, getting closer to the cause of the reactivation areas.

Maybe Mike of Tim can add their tips here (or others, except for the
"snake oil
enemy lady", Angela), that would be
greatly appreciated.

Perl Molson, the fella who wants to get closer into understanding the
herpes in layman's terms.

Latent herpes simplex virus in human trigeminal ganglia. Detection of
an immediate early gene "anti-sense" transcript by in situ
hybridization

KD Croen, JM Ostrove, LJ Dragovic, JE Smialek, and SE Straus
     
Table of Contents  
Find Similar Articles in the Journal
Notify a friend about this article  

   
Add to Personal Archive
Download to Citation Manager
Alert me when this article is cited

   
Related Articles in Medline  
Articles in Medline by Author:  Croen, K. D.
 Straus, S. E.  

Medline Citation  


Abstract

We used in situ hybridization to study the expression of herpes
simplex virus type 1 genes during latent infections of human sensory
ganglia. Trigeminal ganglia were recovered at autopsy from 24 subjects
with no evidence of an active herpetic infection. These ganglia were
hybridized to 35S-labeled single-stranded RNA probes spanning 72
percent of the herpes simplex genome. In the ganglia of 16 subjects,
0.2 to 4.3 percent of the neuronal cells contained abundant nuclear
signals for viral RNA. Ganglia from three patients with low or
undetectable levels of antibodies to herpes simplex type 1 lacked
viral RNA signals, whereas the ganglia from all of six patients with
elevated antibody titers showed viral RNA signals. Transcription was
detected only from the region of the viral genome containing a gene
that encodes an immediate early protein known as the infected-cell
protein number zero (ICP0). However, normal ("sense") transcripts of
this gene, which are prominent in an acute infection, were not
detected. In contrast, a novel transcript was found overlapping with,
but opposite in direction to, the ICP0 transcript (and was therefore
"anti-sense"). Although this transcript has been only partially
characterized, we believe that it may have a role in maintaining the
latency of herpes simplex virus.

http://content.nejm.org/cgi/content/abstract/317/23/1427

The transgenic immediate early (ICP4) promoter of Herpes Simplex
Virus-1 is activated in Schwann cells but not in neurons in trigeminal
ganglia of latently infected mice
Naomi S. Taus and William J. Mitchell
Herpes simplex virus-1 (HSV-1), a human pathogen, establishes a
lifelong (latent) infection in neurons of sensory ganglia, including
those of the trigeminal ganglia. Periodically, the virus reactivates
from latency and can be transmitted to new hosts. Latent infection has
been hypothesized to be regulated by restriction of viral immediate
early (IE) gene expression in neurons. Numerous in situ hybridization
studies have failed to detect the presence of viral IE gene
transcripts in latently infected neurons. However, IE gene
transcripts, including ICP4, have been detected by RT-PCR in
homogenates of latently infected trigeminal ganglia (Kramer and Coen,
1995). We used transgenic mice containing the HSV-1 ICP4 promoter
fused to the coding sequence of the  -galactosidase gene to determine
whether neurons in latently infected trigeminal ganglia could activate
the ICP4 promoter. Mice were inoculated via the corneal route with
HSV-1 strain F and trigeminal ganglia were examined for
-galactosidase positive cells at 5, 11, 23, and 37 days post infection
(DPI). At 5 DPI the number of  -galactosidase positive neurons and
non-neuronal cells present in trigeminal ganglia was similar. The
number of positive neurons decreased at 11 DPI and returned to the
level of mock inoculated transgenic controls at 23 and 37 DPI (latent
infection). The number of positive non-neuronal cells increased at 11,
23, and 37 DPI and remained above the level that was observed at 5
DPI. Co-labeling for  -galactosidase and cell-type specific markers
confirmed that the transgenic ICP4 promoter was not activated in
neurons but was activated in Schwann cells during latent infection.
These findings support the hypothesis that neurons restrict the
expression of the HSV-1 IE genes during latent infection. Activation
of the ICP4 promoter in Schwann cells is probably not related to the
regulation of latent neuronal infection

http://www.biotech.missouri.edu/mbp/exchange/mbw01/abstracts/TausN.html

Herpes simplex virus type 1 (HSV-1) latent infection in vivo is
characterized by the constitutive expression of the latency-associated
transcripts (LAT), which originate from the LAT promoter (LAP). In an
attempt to determine the functional parts of LAP, we previously
demonstrated that viruses harboring a DNA fragment 3' of the LAT
promoter itself were able to maintain detectable promoter expression
throughout latency whereas viruses not containing this element could
not (J. R. Lokensgard, H. Berthomme, and L. T. Feldman, J. Virol.
71:6714-6719, 1997). This element was therefore called a long-term
expression element (LTE). To further study the role of the LTE, we
constructed plasmids containing a DNA fragment encompassing the LTE
inserted into a synthetic intron between the reporter lacZ gene and
either the LAT or the HSV-1 thymidine kinase promoter.
Transient-expression experiments with both neuronal and nonneuronal
cell lines showed that the LTE locus has an enhancer activity that
does not activate the cytomegalovirus enhancer but does activate the
promoters such as the LAT promoter and the thymidine kinase promoter.
The enhancement of these two promoters occurs in both neuronal and
nonneuronal cell lines. Recombinant viruses containing enhancer
constructs were constructed, and these demonstrated that the enhancer
functioned when present in the context of the viral DNA, both for in
vitro infections of cells in culture and for in vivo infections of
neurons in mouse dorsal root ganglia. In the infections of mouse
dorsal root ganglia, there was a very high level of promoter activity
in neurons infected with viruses bearing the LAT promoter-enhancer,
but this decreased after the first 2 or 3 weeks. By 18 days
postinfection, neurons harboring latent virus without the enhancer
showed no -galactosidase (-gal) staining whereas those harboring
latent virus containing the enhancer continued to show -gal staining
for long periods, extending to at least 6 months postinfection, the
longest time examined.

   INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References  
A hallmark of herpesviruses is the ability to establish a lifelong
latent infection in their hosts. Herpes simplex virus type 1 (HSV-1)
establishes a latent infection in neurons of the peripheral nervous
system in both their natural host, humans, and a variety of animal
models (29). During the course of latency, virtually no expression can
be detected from the many genes of the lytic cycle. Instead, only a
single region of the viral DNA expresses RNA transcripts of sufficient
quantity to be detected by in situ hybridization. These viral RNAs are
the latency-associated transcripts (LATs), which originate in a region
in the long repeat elements of the viral genome (6, 7, 25, 27, 32,
33). The latency-associated promoter (LAP) is thought to express a
single primary LAT, referred to as the minor LAT, which is then
spliced, leading to two abundant RNA species referred to as the major
LAT RNAs (2, 11, 35-38). These major LAT RNAs, of 1.5 and 2 kb, are
stable introns which are antisense to part of the third exon of the
ICP0 mRNA (8, 13).

Since the discovery of the LAT RNAs, there has been speculation about
their function. The strong accumulation of these RNAs in the nuclei of
the latently infected cells in vivo led several laboratories to
examine their role in the establishment and maintenance of latency and
reactivation. Previous studies showed that viruses with the LAT
introns or the LAP deleted were very capable of establishing a latent
infection (19, 20). On the other hand, viruses with part or all of the
LAP deleted were deficient in reactivation from the latent state (3,
18, 22). Therefore, for many years it was accepted that LAP mutants
grew equally as well as wild-type viruses in sensory neurons in vivo
and established latency as well but failed to reactivate. However,
other reports have questioned this statement and shown that deletion
of LAP reduced the ability of such mutant viruses to enter the latent
state (30, 34), indicating that the LAT locus may promote latent
infection. In addition, another study showed that mutant viruses
unable to produce LATs synthesize productive-cycle genes in a greater
number of neurons in vivo than wild-type viruses do (16). In that
report, the authors hypothesized that this ability to grow better
during the acute infection in vivo could lead to an enhanced neuronal
cell death, which could explain the reduced frequency for reactivation
of the LAT viruses.

We were interested in how the LAP remains active in latently infected
neurons in vivo whereas all other viral promoters fail to express RNA
after the first week of infection. Previously, we and others have
reported that viruses containing reporter constructs driven by the LAP
only do not remain active well into latency but instead appear to shut
off transcription some time during the first week or two of infection.
We later found that a region downstream of the LAT transcription start
site appeared to restore the ability of the LAP to continue to
function during latency. We term this region of the LAT transcription
unit the long-term expression element (LTE) region (23). In this
study, insertion of a DNA fragment of more than 1 kb between the LAP
and the lacZ gene allowed the LAP to continue to function throughout
latency, as demonstrated by RNase protection assays of lacZ mRNA.
Similarly, Perng et al. showed by reverse transcription-PCR analysis
that viruses harboring the LAT promoter and the downstream 1.5kb of
DNA were able to continue synthesizing RNA during latency (27). Also,
Lachman and Efstathiou showed that by inserting an IRES element
between the LAT promoter and this region, expression during latency
was observed (21).

To further map the LTE function within this large viral DNA fragment,
we wanted to make deletions of this sequence for insertion into
recombinant viruses. Because the lacZ mRNA is rather unstable, we
needed a more sensitive assay for measuring LTE function during
latency. To this end, we placed the DNA fragment encoding the LTE
function within an intron. This allowed its insertion between the LAP
and the lacZ gene without disrupting translation of the lacZ mRNA. By
this technique, we were able to measure LAP activity in vivo by
measuring -galactosidase activity, an approach that is both more
sensitive and more convenient than the RNase protection assay.

Using different recombinant viruses based on this approach, we found
that the LTE region substantially increased LAP activity, both in the
context of plasmid DNA in transient-transfection assays and in the
context of viral DNA. In infections using recombinant viruses in vivo,
the presence of the LTE region enhanced LAP activity during the first
weeks of infection. Thereafter, the activity declined but the presence
of the enhancer kept the LAP far more active throughout latency than
was found in viruses lacking the enhancer. These experiments not only
highlight the existence of a new function within the LAT region but
also may shed some light on the mechanism by which viruses containing
this region continue transcription throughout latency.

   MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References  
Plasmids. The plasmids used in this study are displayed in Fig. 1A.
Plasmid pHB18 was derived, with minor modifications, from plasmid pJA1
described previously (23). It contains the LAP extending from a SmaI
site to a SacII site (positions 117938 to 118843 on the HSV-1 genome)
upstream from the reporter gene lacZ (from pCH110; Pharmacia).
Plasmids pHB22F and pHB22R were derived from pHB18 by first inserting
the LTE sequence from a PstI site to a HpaI site (positions 118862 to
120303) as a BamHI-BglII fragment into the BglII site of the intron
sequence (GGATCCAGGTAAGCCTAGATCTCTAACCATGTTCATGCCTTCTTTTCCTAGGATCC)
either in the forward (pHB22F) or in the reverse (pHB22R) orientation
and then inserting the LTE-intron sequence as a BamHI-BamHI fragment
into a BamHI site between LAP and lacZ of pHB18. Plasmid pHB23 was
similar to pHB22F, but the LTE sequence was replaced by an inverted
855-bp DNA fragment internal to the coding sequence of the I-Sce1 gene
of Saccharomyces cerevisiae. Plasmids pHB17.1, pHB12F, and pHB12R are
the counterparts of pHB18, pHB22F, and pHB22R, respectively, with the
LAP being replaced by the cytomegalovirus (CMV) enhancer-promoter.
Plasmid pHB30F was derived from pHB17.1 by inserting the LTE sequence
(BamHI-BglII fragment) alone in the forward orientation into the BamHI
site between the CMV promoter and the lacZ gene of pHB17.1. Plasmids
pHB16, pHB19F, and pHB19R are the counterparts of pHB18, pHB22F, and
pHB22R, respectively, with the LAP being replaced by the HSV-1
thymidine kinase (TK) promoter (from a PvuII site at position 48108 to
a BglII site at position 47855).

View larger version (1414K):
[in this window]
[in a new window]
  FIG. 1.   Graphic map of the DNA structures of plasmids and
viruses. (A) Plasmids were constructed by inserting either the CMV
enhancer/promoter, the LAP, or the HSV-1 TK promoter upstream from the
reporter gene lacZ. The presence of the LTE region and the synthetic
intron are indicated by the LTE box and the splice donor (SD) and the
splice acceptor (SA) sites, respectively. Arrows show the orientation
of the inserted LTE or Sce (internal fragment of the I-SceI gene of S.
cerevisiae) sequences. All transcriptional units were flanked with
sequences from the HSV-1 gC gene, to allow the recombination at the gC
locus of virus KOS dl1.8 HSV-1 (21), leading to KOS18, KOS22F, and
KOS22R viruses. (B) Complete genome of HSV-1 and an expanded view of
the long internal repeat (IRL). Positions on the HSV-1 genome as well
as the flanking restriction sites of the LAP and LTE sequences used in
this study are also indicated. The bottom line shows the region of the
LAT intron (dark rectangle) and its overlap with the third exon of the
ICP0 mRNA.



Cells and viruses. African green monkey kidney (Vero), rabbit skin
(RS), and ND7 cells were maintained in Dulbecco modified Eagle medium
plus 10% fetal bovine serum, in Earle's minimum essential medium plus
5% newborn calf serum, and RPMI 1640 medium plus 10% fetal bovine
serum, respectively. All media were also supplemented with penicillin
and streptomycin and were buffered with sodium bicarbonate. Vero cells
were used for selection, propagation, and titer determination of the
recombinant viruses. RS and ND7 cells were used for gene expression
analysis following transfection of plasmids or productive infection.

The recombinant viruses described in this report, hereafter designated
KOS18, KOS22F, and KOS22R, were constructed by recombination at the gC
locus between the parental virus KOS dl1.8 HSV-1 (kindly provided by
David Leib [22]) and plasmids pHB18, pHB22F, and pHB22R, respectively.
These viruses were selected, plaque purified, and produced as
previously described (10).

Animal inoculation. All animals were manipulated using institutionally
approved animal welfare procedures. Experiments were carried out
essentially as previously described (10). Briefly, 6-week-old female
Swiss Webster mice were anesthetized by ether inhalation and a 10%
NaCl solution was injected subcutaneously in the footpads. After 3 h,
the mice were anesthetized by intraperitoneal injection of
pentobarbital (60 mg/kg). The skin of the footpads was removed, and
107 PFU of the viral stocks was applied on each footpad. The
infections were carried out for at least an hour.

Histochemical staining. At the times indicated in Fig. 5, infected
mice were euthanized by Halothane inhalation and exsanguinated by
transcardiac perfusion with phosphate-buffered-saline (PBS) through
the left ventricle after cutting the right atrium. The mouse tissue
was fixed with a PBS solution containing 2% formaldehyde and 0.2%
glutaraldehyde. The L3 to L6 dorsal root ganglia (DRG) were surgically
removed and further fixed for 15 min in the same fixative solution.
Histochemical staining was conducted exactly as previously described
(10).

Immunohistochemistry. At the times indicated in Fig. 7, mice were
euthanized by carbon dioxide inhalation and transcardiac perfusion
with PBS (pH 7.2) followed by perfusion with 4% paraformaldehyde in
PBS. The dorsal root ganglia from three experimental animals were then
removed, combined, and immersion fixed at 4°C in 4% paraformaldehyde
for 1 h. Fixed tissue was then equilibrated with 20% sucrose, embedded
in OCT, and frozen in liquid nitrogen (23). Serial sections (6 µm)
were cut from frozen ganglia and collected as five alternative sets
onto a Superfrost plus slide (Fisher). The tissue slides were stored
at 20°C.

For dual-immunofluorescence studies of -galactosidase and HSV antigen
expression, tissue sections were first incubated for 1 h at room
temperature with rabbit anti--galactosidase antiserum (Cappel, Durham,
N.C.) diluted 1:700 in PBS. Tissue sections were then sequentially
incubated with biotinylated goat anti-rabbit immunoglobulin G (Vector
Labs, Burlingham, Calif.) for 1 h, rhodamine600 avidin D (Vector)
diluted 1:1,200 for 40 min, and biotinylated goat anti-avidin D
diluted 1:1,200 for 40 min. After being washed, the sections were
blocked with 10% normal rabbit serum for 10 min and incubated for 40
min with both fluorescein isothiocyanate-conjugated rabbit anti-HSV-1
(Dako Corp., Carpinteria, Calif.) diluted 1:100 and rhodamine600
avidin D diluted 1:1,200. Sections were then washed and mounted with
coverslips using Vectashield (Vector). Stained slides were evaluated
using a Nikon fluorescence photomicroscope.

Quantification of -galactosidase activity. Tissue culture plates (60
mm) containing 1 × 106 (transfection) or 3 × 106 (infection) RS
(fibroblast) or ND7 (neuronal) cells were either transfected with 2 µg
of DNA of the indicated plasmids previously mixed with 10 µl of
Lipofectin as specified by the manufacturer (Gibco) or infected at a
multiplicity of infection of 3 PFU/cell. At 2 days postinfection
(p.i.) or at 2 days posttransfection the cells were harvested in 200
µl of PBS and immediately frozen.

Unfixed L3 to L6 DRG from infected mice (three mice per time point per
virus) were removed as indicated above and immediately frozen.
Cellular extracts were produced by grinding these DRG in 200 µl of
ice-cold PBS in a 0.1-ml Dounce homogenizer. Prior to use, the cells
were frozen and thawed three times and cellular debris were briefly
microcentrifuged. Aliquots (10 to 40 µl) of the supernatants were
incubated in the previously described in vitro -galactosidase assay
(9), using chlorophenolred--D-galactopyranoside (CPRG; Sigma) as the
substrate.

   RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References  
Validation of the intron strategy. We previously showed that a DNA
fragment 3' of the LAP but within the LAT transcription unit was able
to support long-term expression of the LAP during latency (23).
Because the lacZ mRNA was relatively unstable, leading to a signal
barely detectable by the RNase protection assay, it was difficult to
quantify the effect of the LTE on the activity of LAP. Another
difficulty of the previous assay system is that the presence of the
LTE sequence, inserted between the promoter and the lacZ coding
region, prevented translation of the lacZ mRNA (23). To address these
problems, we inserted the LTE DNA fragment (positions 118862 to
120303) into a cassette flanked by the consensus splice donor, branch
point, and splice acceptor sites and cloned the LTE/intron sequence
between the promoters and the lacZ reporter gene (see Materials and
Methods) (Fig. 1A). This construction should allow the LTE region to
function while allowing translation of the reporter gene, which would
increase the sensitivity of our assays. To demonstrate the effect of
the splicing signals on mRNA translation, we inserted the LTE, either
alone or within an intron, between the CMV immediate-early
enhancer-promoter and the lacZ gene. We then transfected the plasmids
in RS cells and analyzed the reporter gene expression using an in
vitro enzymatic assay to quantify the -galactosidase activity. As
shown in Fig. 2, -galactosidase activity is very high for transfection
of a control plasmid in which the CMV immediate-early enhancer is
driving the lacZ gene, pHB17.1. Insertion of the LTE fragment without
flanking intron signals, pHB30F, blocked the majority of lacZ
expression (compare pHB17.1 to pHB30F). By contrast, insertion of the
LTE as an intron between the promoter and the lacZ gene resulted in
transient-transfection assays with high levels of -galactosidase
activity. This was true whether the LTE was inserted in the forward
(natural) direction, pHB12F, or in the reverse direction, pHB12R. In
each case, the level of expression was very similar to that obtained
with the CMV-driven lacZ gene, pHB17.1. In other words, insertion of
the LTE within the context of an intron allowed efficient translation
of the lacZ mRNA but did not decrease or increase the level of
expression compared to that obtained with a plasmid lacking the LTE
and splicing signals. From these results, we conclude that insertion
of the LTE without splicing signals prevented efficient expression of
a downstream coding sequence (as stated previously) and that the
LTE/intron sequence merely restored the same level of CMV
promoter-enhancer activity. Therefore, we could apply this approach to
other experiments to further analyze the role of the LTE.

View larger version (107K):
[in this window]
[in a new window]
  FIG. 2.   -Galactosidase activity from transfections of the CMV
promoter plasmids. Dishes (60 mm) containing 106 RS cells were
transfected independently with 2 µg of DNA of plasmids pHB17.1,
pHB30F, pHB12F, and pHB12R. At 2 days post-transfection,
-galactosidase activity was determined in vitro using CPRG as the
substrate. Values are indicated as the mean of experiments conducted
in triplicate and are expressed as fold increase over background.



The LTE region has an enhancer activity for the LAP. To construct
viruses containing the LTE/intron in the context of the LAP, we first
constructed a set of plasmids and examined their expression in
transient-transfection assays. In our previous work, we had inserted a
similar but slightly shorter LTE DNA fragment between the LAP and the
lacZ gene. As explained in the introduction, this LTE fragment blocked
translation of the lacZ mRNA (24). We again transfected this
construct, under the CMV enhancer, in pHB30 (see above) and again
observed a strong block of translation, which was alleviated when the
LTE fragment was placed in an intron. Because we had already shown
that the LAP-LTE constructs were not translated, we excluded them from
further study here. Instead, a control plasmid, pHB18, was
constructed, in which the LAP was placed in front of the lacZ gene
(Fig. 1A). The activity of this plasmid was compared to that of two
others in which the LTE was inserted in the context of an intron
between the LAP and the lacZ gene, in either the forward (pHB22F) or
the reverse (pHB22R) direction (Fig. 1A). These three plasmids were
transfected into ND7 cells, a neuronal cell line representing a fusion
between neuroblastoma cells and a primary culture of neurons
originating from DRG. Surprisingly, plasmids containing the LTE within
an intron (pHB22F and pHB22R) showed a high increase in lacZ
expression compared to the plasmid (pHB18) lacking an LTE (Fig. 3A).
Thus, the result of inserting the LTE DNA fragment into an intron
between the LAT promoter and lacZ was to increase lacZ expression. To
show that this increased expression was due specifically to the LTE, a
DNA fragment from the I-Sce1 gene of S. cerevisiae was inserted in the
reverse orientation into the intron in place of the LTE, leading to
plasmid pHB23. The transient-expression experiment performed with
pHB18, pHB22F, pHB22R, and pHB23 in ND7 cells showed that this I-Sce1
DNA fragment was not able to increase the expression of lacZ (Fig.
3B). Therefore, the LTE sequence is able to specifically increase the
expression of the reporter gene when placed in an intron between LAP
and lacZ, in a manner independent of its orientation. Considering that
the LTE, when not placed in the context of an intron, was unable to
increase the expression of either the LAT or the CMV enhancer (23)
(Fig. 2), it is unlikely that the increased expression of pHB22F and
pHB22R over the control pHB18 is due to the activity of a promoter
within the LTE. Furthermore, if this activity were due to a promoter,
one would expect it to be directional; thus, the fact that both
orientations of the LTE increased the level of expression of the LAT
promoter also suggests that the LTE does not contribute a
promoter-like activity in these transfections.

The LTE enhancer activity is not tissue specific or promoter specific.
To determine if the LTE functions in a tissue-specific manner, rabbit
skin cells (fibroblasts) were transfected with the three plasmids,
pHB18, pHB22F, and pHB22R. The results showed a similar fold increase
in lacZ gene expression for both pHB22F and pHB22R over pHB18 in these
cells to that in ND7 cells (Fig. 3A). Therefore, the enhancer function
of the LTE sequence seemed not to be specific to a particular cell
line.

View larger version (36K):
[in this window]
[in a new window]
  FIG. 3.   -Galactosidase activity from transfections of the LAT or
TK promoter plasmids. (A and B) Plasmids pHB18, pHB22F, pHB22R, and
pHB23 were all or partly used to transfect RS (A) or ND7 (B) cells
independently as described in Materials and Methods. (C) Similarly,
plasmids pHB16, pHB19F, and pHB19R were transfected in RS cells. At 2
days posttransfection, -galactosidase activity was measured using the
CPRG assay. Values are indicated as the mean of experiments conducted
in triplicate and are expressed as fold increase over background.



To study a potential effect of the LTE region on another promoter than
LAP, another set of plasmids was also constructed. Plasmids pHB16,
pHB19F, and pHB19R, bearing the lacZ gene downstream from an early
viral promoter, the TK promoter (position 48108 to position 47855),
alone (pHB16) or with the LTE inserted in the forward (pHB19F) or
reverse (pHB19R) orientation into the intron (Fig. 1a) were then
transfected into RS cells. The results of this transient-expression
experiment showed that lacZ expression from pHB19F and pHB19R was
significantly higher than that from pHB16 (Fig. 3C), suggesting that
the LTE enhancer can function with another promoter than LAP and is
therefore not specific to a promoter.

The LTE region increases gene expression in an orientation-dependent
manner during productive infection in vitro. To study the effect of
the LTE region on the activity of the LAT promoter in the context of
the virus, the three plasmids pHB18, pHB22F, and pHB22R were inserted
into the gC locus of HSV-1. Because of the extensive homology to the
two copies of the LTE and LAP in the long repeat regions, HSV-1 KOS
dl1.8, a LAT region deletion virus described previously by Leib et al.
(22), was used as the parental strain. Recombinant viruses were
screened for the insertion of the lacZ gene and plaque purified a
total of five times. The DNA structure of each recombinant virus was
verified by Southern blot hybridization (data not shown). RS cells and
ND7 cells were infected at a multiplicity of infection of 3 PFU per
cell. At 2 days later, the infected cells were harvested and
-galactosidase activity was determined using an in vitro enzymatic
assay. As shown in Fig. 4, there was no significant difference in lacZ
expression between KOS18 and KOS22R. Only KOS22F-infected cells showed
an increase beyond the control KOS18-infected cells. Since it has been
shown that the ICP4 protein down regulates the LAP during productive
infection by binding to the ICP4 binding motif at the LAP cap site (1,
2, 14), we assume that LAP is repressed in all three viruses during
the lytic cycle. Therefore, the lacZ expressions observed with KOS18
and KOS22R corresponded to a background expression from cells infected
with lacZ coding sequence-containing viruses. As expected from our
previous study of LAP activity, the background expression from KOS18,
KOS22F, and KOS22R is much higher in ND7 than in RS cells (9).

View larger version (50K):
[in this window]
[in a new window]
  FIG. 4.   -Galactosidase activity from infected RS and ND7 cells in
culture. RS and ND7 cells grown to near confluence were either mock
infected or infected with KOS18, KOS22F, and KOS22R independently at a
MOI of 3 PFU per cell. These viruses corresponded respectively to the
insertion of plasmid pHB18, pHB22F, and pHB22R at the gC locus of the
parental KOS dl1.8 HSV-1 (21). At 2 days p.i., cells were harvested
and lysed and -galactosidase activity was determined using the CPRG
assay. Values are indicated as the mean of experiments conducted in
triplicate and are expressed as fold increase over background.



lacZ expression arising from KOS22F-infected cells was significantly
higher than that from KOS18- and KOS22R-infected cells in the same
infected cell line, indicating that the lacZ gene is highly expressed
during productive infection in vitro only when the LTE is inserted
into the intron in the forward orientation. These results, markedly
different from those obtained in transient expression with the
plasmids, showed that lacZ gene expression is dependent on the
orientation of the LTE. The LTE contains LAP2, a viral promoter that
is active only in the lytic cycle (17). Although LAP2 expression could
explain the increased expression from virus 22F, it is several hundred
bases from the splice acceptor site and would require the utilization
of a cryptic splice donor site to avoid several ATG codons upstream of
the lacZ gene. Perhaps a more likely reason for increased expression
from the 22F virus is the presence of a TATA element just upstream of
the HpaI site, only a short distance from the end of the LTE. This
TATA box would be activated by ICP4, rather than repressed;
furthermore, this element is very far away from the lacZ gene in virus
KOS22R.

The LTE region increased gene expression during acute and latent
infection in vivo. To examine the effect of the LTE on LAP expression
in vivo, mice were infected via the footpads of the rear limbs. On
days 4 and 12, DRG were removed and analyzed for -galactosidase
activity by in situ staining. As shown in Fig. 5, whole ganglia
stained for -galactosidase activity showed a large increase in KOS22F-
and KOS22R-infected ganglia compared to KOS18-infected ganglia at 4
days p.i. By 12 days p.i., both KOS22F and KOS22R showed less total
activity than on day 4 but substantially more activity than KOS18 on
day 12, for which no detectable expression was observed.

View larger version (141110K):
[in this window]
[in a new window]
  FIG. 5.   -Galactosidase activity in whole-mount infected DRG by
histochemical staining. Swiss Webster mice were inoculated with KOS18,
KOS22F, and KOS22R, and DRG were removed and stained as indicated in
Materials and Methods. L3, L4, and L5 DRG infected by KOS18 at 4 days
p.i. (A) or 12 days p.i. (B), by KOS22F at 4 days p.i. (C) or 12 days
p.i. (D), by KOS22R at 4 days p.i. (E) or 12 days p.i. (F), or by
KOS22F at 6 months p.i. (G) are shown.



To quantify the lacZ gene expression and to examine the effect of the
enhancer over a longer period of latency, we extended the period of
infection. At 4, 12, and 28 days p.i., unfixed L3 to L6 DRG were
removed and used to produce cellular extracts, which were subsequently
analyzed for -galactosidase activity in an in vitro quantitative assay
(CPRG assay). The results showed that at 4 days p.i., -galactosidase
activity from KOS22F-infected DRG was 18-fold higher than from
KOS18-infected DRG and 3-fold higher than from KOS22R-infected DRG
(Fig. 6). At 12 days p.i., however, expression from both KOS22F- and
KOS22R-infected DRG were clearly reduced by about 50%. As expected, by
12 days p.i., lacZ gene expression originating from KOS18-infected DRG
was not significantly different from the background level. Also, at 28
days p.i., no -galactosidase activity was observed for KOS18-infected
DRG. This has been a consistent observation in our laboratory, i.e.,
that just pairing the upstream LAP region to the lacZ gene does not
result in long-term expression in vivo (9, 22). By contrast,
-galactosidase activity could still be detected at 28 days p.i. for
both KOS22F- and KOS22R-infected DRG, although the level of expression
was markedly reduced compared to the expression at 4 days p.i.

View larger version (42K):
[in this window]
[in a new window]
  FIG. 6.   -Galactosidase activity in infected DRG extracts by the
quantitative CPRG assay. Swiss Webster mice were inoculated with
KOS18, KOS22F, and KOS22R viruses. At the indicated time, cellular
extracts from pooled L3, L4, L5, and L6 DRG were produced and used to
quantify lacZ gene expression as indicated in Materials and Methods.
Values are the mean of the DRG from three mice per time point per
virus.



It has been our experience that by 42 days p.i., the level of LAP
activity in vivo has essentially reached a plateau. This is true for
measuring the levels of the LAT intron, or when the LAP was paired
with a long terminal repeat element from a retrovirus to generate
long-term expression from a reporter virus (24). To verify that the
level of expression of LAP-LTE activity was relatively constant, mouse
ganglia latently infected with KOS22F and KOS22R were periodically
removed and stained for activity. A level of expression similar to
that at 28 days p.i. was also observed in KOS22F- and KOS22R-infected
ganglia at 60 days and at 6 months p.i. A picture of the 6-month data
is included in Fig. 5G. Thus, the presence of the LTE/intron sequence
initially stimulated a very dramatic increase in lacZ gene expression
in vivo, which subsequently declined to a lower level. The fact that
the neurons remained blue when infected by a virus harboring the
LTE/intron sequence could be interpreted in different ways and is
discussed below.

It was clear from the data shown in Fig. 5 and 6, that both KOS22F-
and KOS22R-infected ganglia expressed far more -galactosidase protein
than did KOS18-infected ganglia. To ensure that the difference in gene
expression observed in KOS18-, KOS22F-, and KOS22R-infected ganglia
was not due to differences in the abilities of the viruses to grow in
vivo, the titers of each virus per time point per mouse were
determined. As shown in Table 1, titers of KOS18, KOS22F, and KOS22R
ranged from 1.8 × 103 to 3.1 × 103 at 4 days p.i., and as expected, no
infectious virus could be recovered at 12 or at 28 days p.i. Thus, the
differences in expression observed on days 4 and 12 were not due to
differences in viral growth.

                             
View this table:
[in this window]
[in a new window]
  TABLE 1.   Virus titers in infected DRG in vivo



Immunostaining for -galactosidase and viral antigens in infected DRG.
Margolis et al. have previously shown that by 4 days p.i. most neurons
expressing -galactosidase from the LAT promoter were in the latent
phase of infection and did not express viral antigen, although a small
percentage of neurons expressed both -galactosidase and viral antigens
(24). However, we showed earlier in this report that KOS22F virus was
able to express -galactosidase protein in lytically infected cells in
culture. Therefore, it was important to know if the cells staining for
-galactosidase at 4 or 12 days p.i. were lytically or latently
infected. In the present experiment, DRG infected for 4 days (KOS22F)
or for 12 days (KOS22F and KOS22R) were sectioned and double stained
using antisera against -galactosidase and viral antigens. As
qualitatively illustrated in Fig. 7, no viral antigen-positive neurons
were detected at 12 days after KOS22F or KOS22R infection, confirming
our previous data that no infectious virus could be recovered at that
time (Table 1). By contrast, at 4 days p.i., KOS22F- and
KOS22R-infected ganglia harbored both lytically and latently infected
neurons (Fig. 7).

View larger version (64K):
[in this window]
[in a new window]
  FIG. 7.   Immunodetection of -galactosidase (-gal.) and HSV-1
antigens (Ag.) on infected DRG sections. Swiss Webster mice were
inoculated with KOS22F and KOS22R viruses. At the indicated time, DRG
were removed, equilibrated with 20% sucrose, embedded in OCT, and
frozen in liquid nitrogen. Serial sections (6 µm), were cut, stained
for -galactosidase and HSV-1 antigens, and evaluated under a
fluorescence microscope.



   DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References  
During latency, only one transcription unit of the HSV-1 genome is
expressed. The LATs are under the control of the LAP, which is
constitutively active during the course of the latent state. The
reasons why the LAP remains active in latently infected neurons in
vivo whereas all the other promoters are shut down are poorly
understood. In a previous study, we showed that viruses containing a
DNA element located immediately downstream from the transcriptional
start site of LAP were able to continue reporter gene transcription
during latency whereas viruses lacking this element could not (23).
These results were obtained either by in situ staining of or by RNase
protection assay on cellular extracts of DRG acutely infected for 4
days.

The initial aim of the present study was to confirm a role of the LTE
region in helping the LAP remain active during latency. Using a new
approach allowing the expression of a reporter gene situated
downstream from a promoter followed by the LTE, we showed that the LTE
region contains a surprisingly active enhancer of the LAP. This
enhancer activity is bidirectional and increases the activity of the
TK promoter as well. The LTE does not increase the activity of the CMV
enhancer, but it is not unusual for enhancers to not activate other
enhancers.

Another interesting finding in this study is the activity of the LTE
in latently infected neurons. Although the LTE is able to increase the
activity of the LAP within latently infected neurons, the combined
activity of the LAP-LTE substantially decreases between 4 and 28 days
p.i. Despite the loss of activity during this time, the level of
expression of the LAT-LTE viruses at 28 days is considerably higher
than that observed in virus-infected ganglia such as KOS18, which lack
the LTE fragment. Therefore, two things are happening in viruses
harboring the LTE: there is a high level of expression that is slowly
decreased, and the absolute level of expression is higher during
latency. An unresolved question is whether these two things are
manifestations of the same function or whether they derive from two
separate functions. One interpretation of these data is that the LTE
has two functions, an enhancer that functions only transiently and a
long-term expression function. In this model, the LAP in KOS18 is
expressed only during the first week of infection and then is down
regulated by some change, perhaps in the viral chromatin structure.
This results in a gradual loss of -galactosidase activity until none
is detected by day 28. In KOS22F- and KOS22R-infected neurons, it
could be that the LTE loses its enhancer function as a result of the
same changes that cause the LAP in KOS18-infected neurons to lose
activity. Under this model, the LTE fragment contains a separate,
long-term expression function which keeps the LAP active at
approximately the same level as at 4 days p.i. In that respect, it
would be similar to the LTR that we reported previously, which appears
to keep the LAP active throughout latency (24). The fact that KOS22F
expresses much more detectable activity than KOS18 at 28 and 42 days
and 2 and 6 months shows that the LTE exerts a clear difference in
long-term expression. Because the enhancer loses activity and yet
viruses containing it remain more active, there is no way at this
point to rule out the possibility of the LTE containing a long-term
expression function in addition to an enhancer. The only way to rule
that out is by a detailed genetic analysis, which is in progress but
is beyond the scope of the present work.

An alternative explanation is that the LTE contains only a single
function, an enhancer. In this model, when the LAP is down regulated
some time during the first week of infection, the LAP-LTE is similarly
down regulated. Under this model, the LAT-LTE has no long-term
function. Instead, the LAT-LTE construct expresses a detectable level
of -galactosidase protein at 28 days because the initial level of
expression is so much higher than that observed for the LAT-lacZ
constructs. That is, a 20-fold reduction in expression of the LAP-LTE
still results in a level of expression that is detectable at 28 days
p.i. whereas a 20-fold reduction in expression in KOS18-infected
neurons results in loss of detectable activity.

At present, we have not distinguished between these two possibilities.
In either case, the activity of this enhancer is potentially
significant. Recently, authors have shown that there is a latency
establishment defect in mouse trigeminal ganglia for viruses with the
LAP deleted (35). Another group demonstrated that LAP mutants appear
to grow better in neurons in vivo than do wild-type viruses (16). Both
of these studies suggested a potential role for the LAT intron in
opposing ICP0 function. We have previously shown by
transient-expression assays that the LAT intron is capable of blocking
ICP0 protein function (13). The very substantial increase in activity
it contributes to the LAP comes at a time when the virus is capable of
forming either a lytic or a productive infection of the neuron. An
enormous increase in transcription by the LAP would result in a very
large increase in the concentration of the LAT intron, an RNA molecule
that is antisense to the ICP0 mRNA. Thus, the enhancer is in theory
capable of exerting an influence on the establishment properties of
the virus, perhaps giving the virus a push toward the establishment of
a latent infection by increasing the inhibition of ICP0 gene
expression.

In these studies, we also observed what appears to be a lytic promoter
activity within the LTE/intron in the forward direction. Since the
LAP2 is active during a lytic but not a latent infection (5), it is
conceivable that the increased expression observed by lytic infection
with virus KOS22F may be due to LAP2 activity. If it is due to LAP2,
the increased -galactosidase protein expression may be aided by the
splicing cassette, in that a cryptic splice donor may remove start
codons between LAP2 and the splice acceptor site. An alternative
explanation for the lytic activity of KOS22F and not KOS22R is the
presence near the 3' end of the LTE of a TATA sequence. This element
could be transactivated by ICP4 or ICP0, and in the reverse
orientation in KOS22R this element would be even further from the
splice acceptor site than would LAP2. In either case, there is no
evidence that either LAP2 or the TATA element is expressed during
latency. Thus, the significance of the lytic activity of KOS22F is
doubtful.

There is some evidence in the literature to support a role for the
region as being an enhancer as well as playing a role in the lytic
cycle. Previous work has shown that motifs in the LAP2 region of HSV-1
were able to bind HMG1(Y) proteins, thus facilitating the binding of
Sp1 transcription factors (15). HMG1(Y) proteins do not possess an
intrinsic transactivator activity. However, they are known to bind DNA
and to alter the DNA structure (12). This DNA-bending activity is
thought to remodel the promoter region so that it becomes more active
(31). In our model, binding of both HMG1(Y) and Sp1 factors to the
LAP2 region (corresponding approximately to the first half of our LTE
region) would lead to remodeling of LAP1, thus increasing its
activity. As expected, this type of enhancer would be independent of
its orientation and would not be specific to a promoter or to a cell
line since cellular extracts from both HeLa cells and a neuroblastoma
cell line (B103) were able to protect the same region in LAP2 (15).

Recent studies have also shown that HMG1(Y) proteins served as a
coactivators of the HSV-1 ICP4 transcriptional factor in vitro (4,
26), leading to augmentation of the ICP4 activity. Thus, it is
possible that binding of HMG1(Y) proteins within LAP2 would recruit
the ICP4 transactivator when it is synthesized during productive
infection. The LAP2 region would therefore become a very efficient
promoter in the course of the lytic cycle, but the role of this region
would be mainly an enhancer activity for LAP1 during latency.

Finally, we note that some recombinant viruses that are deleted in the
LTE region are also inactive for reactivation from latency. Both the
StyI mutant used by Fraser and colleagues (18a) and the 348 virus used
by Bloom et al. (3) are defective in reactivation from latency. Both
of the deletions are in the RNA sequence 5' of the intron, within the
LTE region, and in both cases it has been difficult to ascribe a
molecular reason for the effect of the deletion on reactivation. It
will be interesting to determine if the cause of the failure of these
viruses to reactivate may be due to the absence of an enhancer
function.

http://jvi.asm.org/cgi/content/full/74/8/3613